99
|
Thermo Fisher
gene exp hprt1 hs01003267 m1 Gene Exp Hprt1 Hs01003267 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp hprt1 hs01003267 m1/product/Thermo Fisher Average 99 stars, based on 1 article reviews
gene exp hprt1 hs01003267 m1 - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
94
|
New England Biolabs
pcr Pcr, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcr/product/New England Biolabs Average 94 stars, based on 1 article reviews
pcr - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
90
|
LG Life
advansure rv real-time pcr kit Advansure Rv Real Time Pcr Kit, supplied by LG Life, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/advansure rv real-time pcr kit/product/LG Life Average 90 stars, based on 1 article reviews
advansure rv real-time pcr kit - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
HiMedia Laboratories
hi-pcr® covid flu rsv multiplex probe pcr kit Hi Pcr® Covid Flu Rsv Multiplex Probe Pcr Kit, supplied by HiMedia Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hi-pcr® covid flu rsv multiplex probe pcr kit/product/HiMedia Laboratories Average 90 stars, based on 1 article reviews
hi-pcr® covid flu rsv multiplex probe pcr kit - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
multiplexing pcr primer 1.0 5’aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct Multiplexing Pcr Primer 1.0 5’aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiplexing pcr primer 1.0 5’aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct/product/Illumina Inc Average 90 stars, based on 1 article reviews
multiplexing pcr primer 1.0 5’aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
BioSewoom Inc
multiplex allelespecific pcr absolute flt3 tkd/itd pcr Multiplex Allelespecific Pcr Absolute Flt3 Tkd/Itd Pcr, supplied by BioSewoom Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiplex allelespecific pcr absolute flt3 tkd/itd pcr/product/BioSewoom Inc Average 90 stars, based on 1 article reviews
multiplex allelespecific pcr absolute flt3 tkd/itd pcr - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Qiagen
qiagen pcr kit Qiagen Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/qiagen pcr kit/product/Qiagen Average 90 stars, based on 1 article reviews
qiagen pcr kit - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Agilent technologies
mx3005p pcr multiplex quantitative pcr instrument Mx3005p Pcr Multiplex Quantitative Pcr Instrument, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mx3005p pcr multiplex quantitative pcr instrument/product/Agilent technologies Average 90 stars, based on 1 article reviews
mx3005p pcr multiplex quantitative pcr instrument - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
TechLab Inc
e. histolytica ii elisa test E. Histolytica Ii Elisa Test, supplied by TechLab Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/e. histolytica ii elisa test/product/TechLab Inc Average 90 stars, based on 1 article reviews
e. histolytica ii elisa test - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Seegene Technologies
multiplex rrt-pcr kit allplextm 2019-ncov assay Multiplex Rrt Pcr Kit Allplextm 2019 Ncov Assay, supplied by Seegene Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiplex rrt-pcr kit allplextm 2019-ncov assay/product/Seegene Technologies Average 90 stars, based on 1 article reviews
multiplex rrt-pcr kit allplextm 2019-ncov assay - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Thermo Fisher
taqman universal pcr mastermix Taqman Universal Pcr Mastermix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/taqman universal pcr mastermix/product/Thermo Fisher Average 90 stars, based on 1 article reviews
taqman universal pcr mastermix - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
96
|
Qiagen
pcr kit Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pcr kit/product/Qiagen Average 96 stars, based on 1 article reviews
pcr kit - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |