nested multiplex pcr panel (meningitis Search Results


99
Thermo Fisher gene exp hprt1 hs01003267 m1
Gene Exp Hprt1 Hs01003267 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp hprt1 hs01003267 m1/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
gene exp hprt1 hs01003267 m1 - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

94
New England Biolabs pcr
Pcr, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr/product/New England Biolabs
Average 94 stars, based on 1 article reviews
pcr - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

90
LG Life advansure rv real-time pcr kit
Advansure Rv Real Time Pcr Kit, supplied by LG Life, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/advansure rv real-time pcr kit/product/LG Life
Average 90 stars, based on 1 article reviews
advansure rv real-time pcr kit - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
HiMedia Laboratories hi-pcr® covid flu rsv multiplex probe pcr kit
Hi Pcr® Covid Flu Rsv Multiplex Probe Pcr Kit, supplied by HiMedia Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hi-pcr® covid flu rsv multiplex probe pcr kit/product/HiMedia Laboratories
Average 90 stars, based on 1 article reviews
hi-pcr® covid flu rsv multiplex probe pcr kit - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc multiplexing pcr primer 1.0 5’aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct
Multiplexing Pcr Primer 1.0 5’aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiplexing pcr primer 1.0 5’aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct/product/Illumina Inc
Average 90 stars, based on 1 article reviews
multiplexing pcr primer 1.0 5’aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttccgatct - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
BioSewoom Inc multiplex allelespecific pcr absolute flt3 tkd/itd pcr
Multiplex Allelespecific Pcr Absolute Flt3 Tkd/Itd Pcr, supplied by BioSewoom Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiplex allelespecific pcr absolute flt3 tkd/itd pcr/product/BioSewoom Inc
Average 90 stars, based on 1 article reviews
multiplex allelespecific pcr absolute flt3 tkd/itd pcr - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Qiagen qiagen pcr kit
Qiagen Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/qiagen pcr kit/product/Qiagen
Average 90 stars, based on 1 article reviews
qiagen pcr kit - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Agilent technologies mx3005p pcr multiplex quantitative pcr instrument
Mx3005p Pcr Multiplex Quantitative Pcr Instrument, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mx3005p pcr multiplex quantitative pcr instrument/product/Agilent technologies
Average 90 stars, based on 1 article reviews
mx3005p pcr multiplex quantitative pcr instrument - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
TechLab Inc e. histolytica ii elisa test
E. Histolytica Ii Elisa Test, supplied by TechLab Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/e. histolytica ii elisa test/product/TechLab Inc
Average 90 stars, based on 1 article reviews
e. histolytica ii elisa test - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Seegene Technologies multiplex rrt-pcr kit allplextm 2019-ncov assay
Multiplex Rrt Pcr Kit Allplextm 2019 Ncov Assay, supplied by Seegene Technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiplex rrt-pcr kit allplextm 2019-ncov assay/product/Seegene Technologies
Average 90 stars, based on 1 article reviews
multiplex rrt-pcr kit allplextm 2019-ncov assay - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Thermo Fisher taqman universal pcr mastermix
Taqman Universal Pcr Mastermix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taqman universal pcr mastermix/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
taqman universal pcr mastermix - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

96
Qiagen pcr kit
Pcr Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr kit/product/Qiagen
Average 96 stars, based on 1 article reviews
pcr kit - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

Image Search Results